bio-crispr-screens-library-design

$npx mdskill add GPTomics/bioSkills/bio-crispr-screens-library-design

Designs CRISPR sgRNA libraries for genetic screens using CRISPOR and BioPython

  • Selects and ranks sgRNAs for knockout, activation, or interference screens
  • Uses CRISPOR, BioPython, MAGeCK, numpy, and pandas for analysis
  • Evaluates on-target efficiency and off-target potential with scoring metrics
  • Returns ranked sgRNA candidates and library composition for experimental use

SKILL.md

.github/skills/bio-crispr-screens-library-designView on GitHub ↗
---
name: bio-crispr-screens-library-design
description: CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.
tool_type: python
primary_tool: crispor
---

## Version Compatibility

Reference examples tested with: BioPython 1.83+, MAGeCK 0.5+, numpy 1.26+, pandas 2.2+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Library Design

**"Design a custom CRISPR library for my screen"** → Select optimal sgRNAs for knockout, CRISPRi/a, or base editing libraries with on-target scoring, off-target filtering, and control guide design.
- Python: CRISPOR-based scoring with `BioPython` for sequence handling

## sgRNA Selection Criteria

**Goal:** Score and rank candidate sgRNAs for a target gene based on design quality metrics.

**Approach:** Scan the gene sequence for PAM sites, extract 20-nt protospacer sequences, score each on GC content, poly-T avoidance, 5' G preference, and length, then return the top-ranked candidates.

```python
import pandas as pd
import numpy as np
from Bio import SeqIO
from Bio.Seq import Seq

def score_sgrna(sequence, pam='NGG'):
    '''Score sgRNA based on multiple criteria.'''
    scores = {}

    gc_content = (sequence.count('G') + sequence.count('C')) / len(sequence)
    scores['gc_content'] = 1 - abs(gc_content - 0.5) * 2

    if len(sequence) >= 4:
        has_poly_t = 'TTTT' in sequence
        scores['poly_t'] = 0 if has_poly_t else 1

    starts_with_g = sequence.startswith('G')
    scores['start_g'] = 1 if starts_with_g else 0.5

    scores['length'] = 1 if len(sequence) == 20 else 0.8

    overall = np.mean(list(scores.values()))
    return overall, scores

def design_sgrnas_for_gene(gene_sequence, n_guides=4, pam='NGG'):
    '''Design sgRNAs targeting a gene.'''
    candidates = []

    pam_pattern = pam.replace('N', '[ACGT]')
    import re

    for strand in ['+', '-']:
        seq = gene_sequence if strand == '+' else str(Seq(gene_sequence).reverse_complement())

        for match in re.finditer(f'([ACGT]{{20}})({pam_pattern})', seq):
            sgrna = match.group(1)
            position = match.start()

            if strand == '-':
                position = len(seq) - position - 23

            score, details = score_sgrna(sgrna)

            candidates.append({
                'sequence': sgrna,
                'pam': match.group(2),
                'strand': strand,
                'position': position,
                'score': score,
                'gc_content': (sgrna.count('G') + sgrna.count('C')) / 20,
                **details
            })

    candidates_df = pd.DataFrame(candidates)
    candidates_df = candidates_df.sort_values('score', ascending=False)

    return candidates_df.head(n_guides)

gene_seq = 'ATGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGG'
guides = design_sgrnas_for_gene(gene_seq, n_guides=5)
print(guides[['sequence', 'position', 'strand', 'score', 'gc_content']])
```

## Library Composition

**Goal:** Assemble a complete sgRNA library targeting a list of genes with appropriate controls.

**Approach:** Design top-scoring guides for each gene, append non-targeting, essential-control, and safe-harbor-control guides, and compile into an ordered library table.

```python
def design_library(gene_list, guides_per_gene=4, include_controls=True):
    '''Design complete library for gene list.'''
    library = []

    for gene in gene_list:
        gene_data = get_gene_sequence(gene)

        guides = design_sgrnas_for_gene(gene_data['sequence'], n_guides=guides_per_gene)

        for idx, guide in guides.iterrows():
            library.append({
                'gene': gene,
                'gene_id': gene_data.get('ensembl_id', ''),
                'guide_number': idx + 1,
                'sequence': guide['sequence'],
                'pam': guide['pam'],
                'position': guide['position'],
                'strand': guide['strand'],
                'score': guide['score'],
                'type': 'targeting'
            })

    if include_controls:
        controls = design_control_guides()
        library.extend(controls)

    return pd.DataFrame(library)

def get_gene_sequence(gene_name):
    '''Fetch gene sequence (placeholder - use Ensembl API or local files).'''
    return {
        'sequence': 'ATGC' * 250,
        'ensembl_id': f'ENSG_{hash(gene_name) % 100000:05d}'
    }

genes = ['TP53', 'BRCA1', 'KRAS', 'MYC', 'CDK4']
library = design_library(genes, guides_per_gene=4)
print(f'Library size: {len(library)} guides')
print(f'Genes: {library["gene"].nunique()}')
```

## Control Guide Design

**Goal:** Design control guide sets for normalization and quality assessment in CRISPR screens.

**Approach:** Generate random non-targeting sequences with acceptable GC content, add validated guides against known essential genes (positive controls) and safe-harbor loci (negative controls).

```python
def design_control_guides(n_nontargeting=100, n_essential=20, n_nonessential=20):
    '''Design control guides for library.'''
    controls = []

    for i in range(n_nontargeting):
        sequence = generate_nontargeting_sequence()
        controls.append({
            'gene': f'NonTargeting_{i+1}',
            'gene_id': '',
            'guide_number': 1,
            'sequence': sequence,
            'pam': 'NGG',
            'position': -1,
            'strand': '',
            'score': 0,
            'type': 'non-targeting'
        })

    essential_genes = ['RPS3', 'RPL11', 'EIF3A', 'POLR2A', 'CDK1']
    for gene in essential_genes[:n_essential]:
        controls.append({
            'gene': gene,
            'gene_id': '',
            'guide_number': 1,
            'sequence': get_validated_guide(gene),
            'pam': 'NGG',
            'position': 0,
            'strand': '+',
            'score': 1,
            'type': 'essential-control'
        })

    nonessential_genes = ['AAVS1', 'ROSA26']
    for gene in nonessential_genes[:n_nonessential]:
        controls.append({
            'gene': gene,
            'gene_id': '',
            'guide_number': 1,
            'sequence': get_validated_guide(gene),
            'pam': 'NGG',
            'position': 0,
            'strand': '+',
            'score': 1,
            'type': 'safe-harbor-control'
        })

    return controls

def generate_nontargeting_sequence(length=20):
    '''Generate random non-targeting sequence.'''
    while True:
        seq = ''.join(np.random.choice(['A', 'C', 'G', 'T'], length))
        gc = (seq.count('G') + seq.count('C')) / length
        if 0.4 <= gc <= 0.6 and 'TTTT' not in seq:
            return seq

def get_validated_guide(gene):
    '''Get validated guide sequence for control gene.'''
    validated = {
        'RPS3': 'GAGCTTCTTCAGCAGCATGG',
        'RPL11': 'GAAACAGGGCATCATCTACG',
        'EIF3A': 'GTGCAAGAGGATGATGACAA',
        'AAVS1': 'GGGGCCACTAGGGACAGGAT',
        'ROSA26': 'GAAGATGGGCGGGAGTCTTC'
    }
    return validated.get(gene, generate_nontargeting_sequence())
```

## Off-Target Analysis

**Goal:** Filter library guides to remove those with excessive off-target genomic matches.

**Approach:** Align each guide sequence against the genome with Bowtie allowing mismatches, count off-target hits within a mismatch threshold, and remove guides exceeding the maximum.

```python
def check_offtargets(guide_sequence, genome_index, max_mismatches=3):
    '''Check for potential off-target sites.'''
    from subprocess import run
    import tempfile

    with tempfile.NamedTemporaryFile(mode='w', suffix='.fa', delete=False) as f:
        f.write(f'>guide\n{guide_sequence}\n')
        query_file = f.name

    result = run(
        ['bowtie', '-a', '-n', str(max_mismatches), '-l', '20', genome_index, '-f', query_file],
        capture_output=True, text=True
    )

    offtargets = []
    for line in result.stdout.strip().split('\n'):
        if line:
            fields = line.split('\t')
            offtargets.append({
                'chromosome': fields[2],
                'position': int(fields[3]),
                'strand': fields[1],
                'mismatches': int(fields[7]) if len(fields) > 7 else 0
            })

    return offtargets

def filter_by_offtargets(library_df, genome_index, max_offtargets=10):
    '''Filter library to remove guides with too many off-targets.'''
    filtered = []

    for _, guide in library_df.iterrows():
        offtargets = check_offtargets(guide['sequence'], genome_index)
        n_offtargets = len([ot for ot in offtargets if ot['mismatches'] <= 2])

        if n_offtargets <= max_offtargets:
            guide_dict = guide.to_dict()
            guide_dict['n_offtargets'] = n_offtargets
            filtered.append(guide_dict)

    return pd.DataFrame(filtered)
```

## Oligo Design for Cloning

**Goal:** Generate forward and reverse oligo sequences ready for ordering and cloning into a lentiviral vector.

**Approach:** Add vector-specific adapter sequences (overhangs for BsmBI or BbsI restriction sites) to each guide and its reverse complement, formatted for the target vector backbone.

```python
def design_oligos(library_df, vector='lentiGuide-Puro'):
    '''Design oligos for library cloning.'''
    vector_specs = {
        'lentiGuide-Puro': {
            'forward_prefix': 'CACCG',
            'forward_suffix': '',
            'reverse_prefix': 'AAAC',
            'reverse_suffix': 'C'
        },
        'pLKO': {
            'forward_prefix': 'CCGG',
            'forward_suffix': 'CTCGAG',
            'reverse_prefix': 'AATTCTCGAG',
            'reverse_suffix': ''
        }
    }

    spec = vector_specs.get(vector, vector_specs['lentiGuide-Puro'])

    oligos = []
    for _, guide in library_df.iterrows():
        seq = guide['sequence']

        forward = spec['forward_prefix'] + seq + spec['forward_suffix']
        reverse = spec['reverse_prefix'] + str(Seq(seq).reverse_complement()) + spec['reverse_suffix']

        oligos.append({
            'guide_id': f"{guide['gene']}_{guide['guide_number']}",
            'gene': guide['gene'],
            'guide_sequence': seq,
            'forward_oligo': forward,
            'reverse_oligo': reverse,
            'type': guide.get('type', 'targeting')
        })

    return pd.DataFrame(oligos)

oligos = design_oligos(library)
oligos.to_csv('library_oligos.csv', index=False)
print(f'Designed {len(oligos)} oligo pairs')
```

## Pool Design for Synthesis

```python
def design_array_oligos(library_df, array_format='12K'):
    '''Design array oligos for pooled synthesis.'''
    formats = {
        '12K': {'capacity': 12000, 'length': 200},
        '92K': {'capacity': 92000, 'length': 150},
        '244K': {'capacity': 244000, 'length': 60}
    }

    spec = formats[array_format]

    primer_5 = 'AGGCTTGGATTTCTATAACTTCGTATAGCATACATTATACGAAGTTAT'
    primer_3 = 'ATAACTTCGTATAATGTATGCTATACGAAGTTATCTTGGATTTCTAGA'
    scaffold = 'GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC'

    array_oligos = []
    for _, guide in library_df.iterrows():
        full_oligo = primer_5 + guide['sequence'] + scaffold + primer_3

        if len(full_oligo) > spec['length']:
            print(f"Warning: {guide['gene']} oligo too long for {array_format}")
            continue

        array_oligos.append({
            'id': f"{guide['gene']}_{guide['guide_number']}",
            'sequence': full_oligo,
            'length': len(full_oligo)
        })

    if len(array_oligos) > spec['capacity']:
        print(f"Warning: Library ({len(array_oligos)}) exceeds {array_format} capacity ({spec['capacity']})")

    return pd.DataFrame(array_oligos)

array_oligos = design_array_oligos(library, '92K')
array_oligos.to_csv('array_synthesis.csv', index=False)
```

## Library QC

```python
def qc_library(library_df):
    '''Quality control checks for library design.'''
    qc = {}

    qc['total_guides'] = len(library_df)
    qc['unique_genes'] = library_df[library_df['type'] == 'targeting']['gene'].nunique()
    qc['guides_per_gene'] = library_df[library_df['type'] == 'targeting'].groupby('gene').size().describe()

    gc_contents = library_df['sequence'].apply(lambda x: (x.count('G') + x.count('C')) / len(x))
    qc['gc_mean'] = gc_contents.mean()
    qc['gc_std'] = gc_contents.std()
    qc['gc_range'] = (gc_contents.min(), gc_contents.max())

    has_poly_t = library_df['sequence'].apply(lambda x: 'TTTT' in x)
    qc['poly_t_count'] = has_poly_t.sum()

    type_counts = library_df['type'].value_counts()
    qc['control_ratio'] = type_counts.get('non-targeting', 0) / len(library_df)

    return qc

qc = qc_library(library)
print('Library QC:')
for key, value in qc.items():
    print(f'  {key}: {value}')
```

## Alternative PAM Systems

The examples above use SpCas9 with NGG PAM. Alternative systems expand targeting range:

| System | PAM | Use Case |
|--------|-----|----------|
| SpCas9 | NGG | Standard, most validated |
| SpCas9-NG | NG | Relaxed PAM requirement |
| SpRY | NRN/NYN | Near-PAMless, broadest targeting |
| Cas12a (Cpf1) | TTTV | AT-rich regions, staggered cuts |
| SaCas9 | NNGRRT | AAV delivery (smaller gene) |

For alternative PAMs, modify the `design_sgrnas_for_gene()` function:

```python
# Cas12a example (TTTV PAM, 23nt guide)
def design_cas12a_guides(gene_sequence, n_guides=4):
    pam_pattern = 'TTT[ACG]'  # TTTV
    guide_length = 23

    for match in re.finditer(f'({pam_pattern})([ACGT]{{{guide_length}}})', gene_sequence):
        pam = match.group(1)
        guide = match.group(2)
        # Cas12a cuts downstream of guide
        # ...
```

## Related Skills

- mageck-analysis - Analyze screen results
- crispresso-editing - Validate editing efficiency
- screen-qc - QC sequencing data
- hit-calling - Identify screen hits

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.