bio-ecological-genomics-edna-metabarcoding

$npx mdskill add GPTomics/bioSkills/bio-ecological-genomics-edna-metabarcoding

Processes eDNA metabarcoding data to identify species occurrences from environmental samples

  • Transforms raw amplicon reads into species occurrence tables for biodiversity monitoring
  • Uses OBITools3, DADA2, and taxonomic databases like BOLD, MIDORI2, or MitoFish
  • Applies primer removal, denoising, chimera detection, and contamination filtering
  • Delivers detection-corrected species lists via occupancy modeling and taxonomic assignment

SKILL.md

.github/skills/bio-ecological-genomics-edna-metabarcodingView on GitHub ↗
---
name: bio-ecological-genomics-edna-metabarcoding
description: Processes environmental DNA metabarcoding data from raw amplicon reads to species occurrence tables using OBITools3, DADA2, and taxonomic assignment against BOLD, MIDORI2, or MitoFish databases. Handles COI, 12S, rbcL, and ITS barcode regions with primer removal, denoising, chimera detection, and contamination filtering via decontam. Includes occupancy modeling (occumb) for detection probability correction. Use when analyzing eDNA from water, soil, or bulk samples for biodiversity monitoring. Not for 16S human microbiome (see microbiome/amplicon-processing).
tool_type: mixed
primary_tool: obitools3
---

## Version Compatibility

Reference examples tested with: DADA2 1.30+, cutadapt 4.4+

Before using code patterns, verify installed versions match. If versions differ:
- R: `packageVersion('<pkg>')` then `?function_name` to verify parameters
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# eDNA Metabarcoding

**"Process my eDNA samples to identify species"** → Transform raw amplicon reads (COI, 12S, rbcL, ITS) into species occurrence tables through primer removal, denoising (DADA2 ASVs), taxonomy assignment against reference databases (BOLD, MIDORI2), and contamination filtering with decontam.
- CLI: `cutadapt` for primer removal, `obi` (OBITools3) for paired-end assembly
- R: `dada2::filterAndTrim()` → `dada()` → `assignTaxonomy()` for ASV pipeline

Processes environmental DNA amplicon reads into species occurrence tables with taxonomy assignment, contamination filtering, and occupancy modeling.

## Primer Removal with Cutadapt

**Goal:** Remove amplicon primers from paired-end eDNA reads while discarding untrimmed read pairs.

**Approach:** Use cutadapt linked adapter trimming with marker-specific primer sequences and minimum overlap enforcement.

Linked adapter trimming removes primer pairs while discarding reads lacking primers:

```bash
# COI primers (mlCOIintF / jgHCO2198)
cutadapt -g 'GGWACWGGWTGAACWGTWTAYCCYCC;min_overlap=20' \
         -G 'TAIACYTCIGGRTGICCRAARAAYCA;min_overlap=20' \
         --discard-untrimmed --pair-filter=any \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         raw_R1.fastq.gz raw_R2.fastq.gz

# 12S MiFish-U primers
cutadapt -g 'GTCGGTAAAACTCGTGCCAGC;min_overlap=18' \
         -G 'CATAGTGGGGTATCTAATCCCAGTTTG;min_overlap=18' \
         --discard-untrimmed --pair-filter=any \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         raw_R1.fastq.gz raw_R2.fastq.gz

# ITS primers (ITS1F / ITS2)
cutadapt -g 'CTTGGTCATTTAGAGGAAGTAA;min_overlap=18' \
         -G 'GCTGCGTTCTTCATCGATGC;min_overlap=18' \
         --discard-untrimmed --pair-filter=any \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         raw_R1.fastq.gz raw_R2.fastq.gz
```

## OBITools3 Pipeline

**Goal:** Process paired-end eDNA reads through the full OBITools3 workflow to produce a taxonomy-assigned species table.

**Approach:** Import reads, align pairs, filter by score/length, demultiplex, dereplicate, denoise with obi clean, assign taxonomy with ecotag, and export.

Full pipeline from paired-end reads to taxonomy table:

```bash
# Import paired FASTQ into OBITools3 DMS
obi import --fastq-input raw_R1.fastq.gz EDNA/reads1
obi import --fastq-input raw_R2.fastq.gz EDNA/reads2

# Paired-end alignment
obi alignpairedend -R EDNA/reads2 EDNA/reads1 EDNA/aligned

# Filter by alignment score and length
# score >= 50: removes poorly overlapping pairs
# length 100-500: typical COI amplicon range
obi grep -p 'sequence["score"] >= 50' EDNA/aligned EDNA/filtered
obi grep -p 'len(sequence) >= 100 and len(sequence) <= 500' \
    EDNA/filtered EDNA/length_filtered

# Demultiplex if needed (with ngsfilter file)
obi ngsfilter -t ngsfilter.txt -u EDNA/unassigned \
    EDNA/length_filtered EDNA/demux

# Dereplicate (obi uniq creates merged_sample attribute automatically)
obi uniq EDNA/demux EDNA/derep

# Remove singletons (count >= 2 removes PCR/sequencing errors)
obi grep -p 'sequence["count"] >= 2' EDNA/derep EDNA/no_singletons

# Denoise (remove PCR/sequencing errors)
# obi clean: denoises by merging low-abundance variants into parent sequences
# -s merged_sample: per-sample denoising (critical for multi-sample datasets)
# -r 0.05: ratio threshold; -H: keep only head sequences (discard variants)
obi clean -s merged_sample -r 0.05 -H EDNA/no_singletons EDNA/denoised

# Taxonomy assignment against reference database
obi ecotag -R EDNA/refdb --taxonomy EDNA/taxonomy EDNA/denoised EDNA/assigned

# Export to tab-separated format
obi export --tab-output EDNA/assigned > species_table.tsv
```

## DADA2 Pipeline for eDNA

**Goal:** Generate amplicon sequence variants (ASVs) from eDNA reads with error correction and chimera removal.

**Approach:** Run the DADA2 workflow: filter/trim, learn error rates, denoise, merge pairs, remove chimeras, and assign taxonomy against a reference database.

DADA2 provides an alternative ASV-based approach:

```r
library(dada2)

# After cutadapt primer removal, get file paths
filt_fwd <- file.path('filtered', basename(fwd_reads))
filt_rev <- file.path('filtered', basename(rev_reads))

# Filter and trim
# maxEE=2: expected errors threshold balancing sensitivity/specificity
# truncLen: set based on quality profile inspection
out <- filterAndTrim(fwd_reads, filt_fwd, rev_reads, filt_rev,
                     maxN = 0, maxEE = c(2, 2), truncQ = 2,
                     minLen = 100, rm.phix = TRUE, multithread = TRUE)

# Learn error rates
err_fwd <- learnErrors(filt_fwd, multithread = TRUE)
err_rev <- learnErrors(filt_rev, multithread = TRUE)

# Denoise
dada_fwd <- dada(filt_fwd, err = err_fwd, multithread = TRUE)
dada_rev <- dada(filt_rev, err = err_rev, multithread = TRUE)

# Merge paired ends
# minOverlap=12: default; increase for short amplicons
merged <- mergePairs(dada_fwd, filt_fwd, dada_rev, filt_rev, minOverlap = 12)

# Build sequence table and remove chimeras
seqtab <- makeSequenceTable(merged)
# Chimera rate <20% is typical; >30% suggests library prep issues
seqtab_nochim <- removeBimeraDenovo(seqtab, method = 'consensus', multithread = TRUE)

# Taxonomy assignment against MIDORI2 or custom database
# minBoot=80: bootstrap confidence for genus-level; 50 for family
taxa <- assignTaxonomy(seqtab_nochim, 'MIDORI2_DADA2_COI.fasta.gz', minBoot = 80)
```

## Reference Databases

| Database | Markers | Format | Source |
|----------|---------|--------|--------|
| MIDORI2 | COI, 12S, 16S, 18S | DADA2, BLAST, OBITools | midori2.info |
| MitoFish | 12S (fish) | DADA2, BLAST | mitofish.aori.u-tokyo.ac.jp |
| BOLD | COI | FASTA, API | boldsystems.org |
| SILVA | 18S | DADA2, mothur | silva-project.net |
| UNITE | ITS (fungi) | DADA2, BLAST | unite.ut.ee |

Formatting a custom FASTA for DADA2 taxonomy assignment:

```bash
# DADA2 format: >Kingdom;Phylum;Class;Order;Family;Genus;Species
# Download MIDORI2 DADA2-formatted reference:
wget https://reference-midori.info/download/Databases/MIDORI2_DADA2/COI/MIDORI2_LONGEST_NUC_GB259_CO1_DADA2.fasta.gz
```

## Contamination Filtering

**Goal:** Identify and remove contaminant ASVs introduced during DNA extraction, PCR, or sequencing.

**Approach:** Apply decontam frequency/prevalence methods using negative controls and DNA concentrations, then remove tag-jumping artifacts with microDecon.

### decontam (frequency/prevalence method)

```r
library(decontam)

# Frequency method: uses DNA concentration from extraction blanks
contam_freq <- isContaminant(seqtab_nochim, conc = dna_concentration, method = 'frequency')

# Prevalence method: compares true samples vs negative controls
contam_prev <- isContaminant(seqtab_nochim, neg = is_negative_control, method = 'prevalence',
                             threshold = 0.5)
# threshold=0.5: ASV must be more prevalent in negatives than samples to flag

# Combined method
contam_both <- isContaminant(seqtab_nochim, conc = dna_concentration,
                             neg = is_negative_control, method = 'both')

seqtab_clean <- seqtab_nochim[, !contam_both$contaminant]
```

### microDecon for tag-jumping artifacts

```r
library(microDecon)

# Remove tag-jumping contamination between samples
# numb.blanks: number of blank/negative control columns at start of table
# numb.ind: vector of sample counts per group
decon_result <- decon(otu_table, numb.blanks = 3, numb.ind = c(10, 10, 10))
cleaned_table <- decon_result$decon.table
```

## Occupancy Modeling with occumb

**Goal:** Correct species occurrence estimates for imperfect detection across replicated eDNA samples.

**Approach:** Fit a multi-species occupancy model via MCMC (JAGS) on a 3D array of replicated read counts to estimate true occupancy probabilities.

Corrects for imperfect detection in metabarcoding replicates:

```r
library(occumb)

# Requires replicated eDNA samples (biological or PCR replicates)
# y: 3D array [species x sites x replicates] of read counts
data <- occumbData(y = count_array, spec_cov = species_covariates,
                   site_cov = site_covariates)

# Fit multi-species occupancy model (requires JAGS)
# n.chains=4, n.iter=10000: standard MCMC settings
fit <- occumb(data = data, n.chains = 4, n.iter = 10000, n.thin = 5, n.burn = 2500)

# Extract corrected occupancy estimates
summary(fit)
```

## Key Thresholds

| Parameter | Value | Rationale |
|-----------|-------|-----------|
| Min read depth per sample | 1,000 | Below this, rare species detection drops significantly |
| Singleton removal | count >= 2 | Singletons often represent sequencing errors |
| Chimera rate | <20% | Higher rates suggest library prep problems |
| COI species identity | >= 97% | Standard COI barcode gap threshold |
| COI genus identity | >= 95% | Conservative genus-level assignment |
| 12S species identity | >= 98% | 12S has less divergence than COI |
| decontam threshold | 0.5 | Balanced false positive/negative rate |
| DADA2 minBoot | 80 | Genus-level confidence; use 50 for family |

## Related Skills

- biodiversity-metrics - Diversity analysis from species occurrence tables
- community-ecology - Environmental gradient analysis of communities
- microbiome/amplicon-processing - 16S clinical microbiome alternative
- read-qc/quality-reports - Upstream read quality assessment

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.