bio-primer-design-qpcr-primers

$npx mdskill add GPTomics/bioSkills/bio-primer-design-qpcr-primers

Design qPCR primers and TaqMan/molecular beacon probes using primer3-py

  • Solve the task of designing primers and probes for real-time PCR assays
  • Depends on primer3-py, BioPython, and pandas for sequence analysis
  • Uses configurable parameters like Tm, spacing, and hydrolysis probe constraints
  • Returns designed primers and probes as output for downstream use

SKILL.md

.github/skills/bio-primer-design-qpcr-primersView on GitHub ↗
---
name: bio-primer-design-qpcr-primers
description: Design qPCR primers and TaqMan/molecular beacon probes using primer3-py. Configure probe Tm, primer-probe spacing, and hydrolysis probe constraints for real-time PCR assays. Use when designing qPCR primers and probes.
tool_type: python
primary_tool: primer3-py
---

## Version Compatibility

Reference examples tested with: BioPython 1.83+, pandas 2.2+, primer3-py 2.0+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# qPCR Primer and Probe Design

Design primers and internal probes for quantitative PCR using primer3-py.

**"Design qPCR primers with probe"** → Generate primer pairs plus internal TaqMan/molecular beacon probes with constrained Tm and spacing.
- Python: `primer3.design_primers(seq_args, global_args)` with `PRIMER_PICK_INTERNAL_OLIGO=1` (primer3-py)

## Required Imports

```python
import primer3
from Bio import SeqIO
```

## Design Primers with TaqMan Probe

```python
sequence = 'ATGCGTACGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG' * 3

result = primer3.design_primers(
    seq_args={'SEQUENCE_TEMPLATE': sequence},
    global_args={
        'PRIMER_PICK_LEFT_PRIMER': 1,
        'PRIMER_PICK_RIGHT_PRIMER': 1,
        'PRIMER_PICK_INTERNAL_OLIGO': 1,  # Design internal probe
        'PRIMER_PRODUCT_SIZE_RANGE': [[70, 150]],  # Short amplicons for qPCR
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MIN_TM': 58.0,
        'PRIMER_MAX_TM': 62.0,
        'PRIMER_INTERNAL_OPT_TM': 70.0,  # Probe Tm ~10C higher
        'PRIMER_INTERNAL_MIN_TM': 68.0,
        'PRIMER_INTERNAL_MAX_TM': 72.0,
        'PRIMER_INTERNAL_MIN_SIZE': 18,
        'PRIMER_INTERNAL_OPT_SIZE': 25,
        'PRIMER_INTERNAL_MAX_SIZE': 30,
    }
)
```

## Extract Probe Results

```python
num_returned = result['PRIMER_PAIR_NUM_RETURNED']
print(f'Found {num_returned} primer/probe sets')

for i in range(num_returned):
    left = result[f'PRIMER_LEFT_{i}_SEQUENCE']
    right = result[f'PRIMER_RIGHT_{i}_SEQUENCE']
    probe = result[f'PRIMER_INTERNAL_{i}_SEQUENCE']
    probe_tm = result[f'PRIMER_INTERNAL_{i}_TM']
    left_tm = result[f'PRIMER_LEFT_{i}_TM']
    right_tm = result[f'PRIMER_RIGHT_{i}_TM']
    product_size = result[f'PRIMER_PAIR_{i}_PRODUCT_SIZE']

    print(f'Set {i}:')
    print(f'  Forward: {left} (Tm: {left_tm:.1f}C)')
    print(f'  Reverse: {right} (Tm: {right_tm:.1f}C)')
    print(f'  Probe:   {probe} (Tm: {probe_tm:.1f}C)')
    print(f'  Product: {product_size}bp')
```

## qPCR-Optimized Parameters

```python
result = primer3.design_primers(
    seq_args={
        'SEQUENCE_TEMPLATE': sequence,
        'SEQUENCE_TARGET': [100, 30],  # Target region for probe
    },
    global_args={
        'PRIMER_PICK_INTERNAL_OLIGO': 1,
        'PRIMER_PRODUCT_SIZE_RANGE': [[60, 100], [100, 150]],  # Prefer short
        'PRIMER_NUM_RETURN': 5,
        # Primer parameters
        'PRIMER_OPT_SIZE': 20,
        'PRIMER_MIN_SIZE': 18,
        'PRIMER_MAX_SIZE': 25,
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MIN_TM': 58.0,
        'PRIMER_MAX_TM': 62.0,
        'PRIMER_OPT_GC_PERCENT': 50.0,
        'PRIMER_MIN_GC': 35.0,
        'PRIMER_MAX_GC': 65.0,
        # Probe parameters (TaqMan: Tm 8-10C higher than primers)
        'PRIMER_INTERNAL_OPT_SIZE': 25,
        'PRIMER_INTERNAL_MIN_SIZE': 18,
        'PRIMER_INTERNAL_MAX_SIZE': 30,
        'PRIMER_INTERNAL_OPT_TM': 70.0,
        'PRIMER_INTERNAL_MIN_TM': 68.0,
        'PRIMER_INTERNAL_MAX_TM': 72.0,
        'PRIMER_INTERNAL_MIN_GC': 30.0,
        'PRIMER_INTERNAL_MAX_GC': 70.0,
        # Avoid G at 5' end of probe (quenches FAM)
        'PRIMER_INTERNAL_MAX_SELF_ANY': 8,
    }
)
```

## TaqMan Probe Constraints

```python
# Additional considerations for TaqMan probes
global_args = {
    'PRIMER_PICK_INTERNAL_OLIGO': 1,
    'PRIMER_PRODUCT_SIZE_RANGE': [[70, 150]],
    # Probe Tm should be 8-10C higher than primers
    'PRIMER_OPT_TM': 60.0,
    'PRIMER_INTERNAL_OPT_TM': 70.0,
    # Probe should be closer to forward primer
    'PRIMER_INTERNAL_MIN_SIZE': 18,
    'PRIMER_INTERNAL_MAX_SIZE': 30,
    # Avoid long poly-X runs in probe
    'PRIMER_INTERNAL_MAX_POLY_X': 3,
}
```

## SYBR Green Primers (No Probe)

```python
# For SYBR Green, design primers without probe
result = primer3.design_primers(
    seq_args={'SEQUENCE_TEMPLATE': sequence},
    global_args={
        'PRIMER_PICK_LEFT_PRIMER': 1,
        'PRIMER_PICK_RIGHT_PRIMER': 1,
        'PRIMER_PICK_INTERNAL_OLIGO': 0,  # No probe
        'PRIMER_PRODUCT_SIZE_RANGE': [[70, 200]],  # Short for qPCR
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MIN_TM': 58.0,
        'PRIMER_MAX_TM': 62.0,
        'PRIMER_MAX_SELF_ANY': 4,  # Strict for SYBR specificity
        'PRIMER_MAX_SELF_END': 2,
        'PRIMER_PAIR_MAX_COMPL_ANY': 4,
        'PRIMER_PAIR_MAX_COMPL_END': 2,
    }
)
```

## Design for Exon-Spanning (Avoid Genomic DNA)

```python
# For cDNA-specific amplification, target exon junction
# Mark the exon junction position
exon_junction = 150  # Position where exons meet

result = primer3.design_primers(
    seq_args={
        'SEQUENCE_TEMPLATE': sequence,
        'SEQUENCE_OVERLAP_JUNCTION_LIST': [exon_junction],  # Primer must span
    },
    global_args={
        'PRIMER_PRODUCT_SIZE_RANGE': [[70, 150]],
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MIN_3_PRIME_OVERLAP_OF_JUNCTION': 4,  # Min bases on each side
    }
)
```

## Multiplex Primer Design

```python
# Design primers for multiple targets with compatible Tms
targets = [
    {'name': 'gene1', 'seq': sequence1, 'target': [100, 30]},
    {'name': 'gene2', 'seq': sequence2, 'target': [150, 30]},
]

results = []
for target in targets:
    result = primer3.design_primers(
        seq_args={
            'SEQUENCE_TEMPLATE': target['seq'],
            'SEQUENCE_ID': target['name'],
            'SEQUENCE_TARGET': target['target'],
        },
        global_args={
            'PRIMER_PICK_INTERNAL_OLIGO': 1,
            'PRIMER_PRODUCT_SIZE_RANGE': [[70, 150]],
            'PRIMER_OPT_TM': 60.0,  # Same Tm for all
            'PRIMER_MAX_TM': 61.0,
            'PRIMER_MIN_TM': 59.0,
            'PRIMER_INTERNAL_OPT_TM': 70.0,
        }
    )
    results.append(result)
```

## Validate Tm Calculations

```python
# Verify Tm with primer3's thermodynamic calculations
primer_seq = 'ATGCGATCGATCGATCGATC'

# Standard Tm
tm = primer3.calc_tm(primer_seq)
print(f'Standard Tm: {tm:.1f}C')

# Tm with specific salt conditions (match your qPCR master mix)
tm_adjusted = primer3.calc_tm(
    primer_seq,
    mv_conc=50.0,    # Monovalent cation (K+, Na+) mM
    dv_conc=3.0,     # Divalent cation (Mg2+) mM
    dntp_conc=0.8,   # dNTP mM (reduces free Mg2+)
    dna_conc=250.0,  # Primer concentration nM
)
print(f'Adjusted Tm: {tm_adjusted:.1f}C')
```

## Format qPCR Results

```python
import pandas as pd

def qpcr_results_to_df(result):
    rows = []
    for i in range(result['PRIMER_PAIR_NUM_RETURNED']):
        row = {
            'pair': i,
            'forward': result[f'PRIMER_LEFT_{i}_SEQUENCE'],
            'reverse': result[f'PRIMER_RIGHT_{i}_SEQUENCE'],
            'fwd_tm': result[f'PRIMER_LEFT_{i}_TM'],
            'rev_tm': result[f'PRIMER_RIGHT_{i}_TM'],
            'product_size': result[f'PRIMER_PAIR_{i}_PRODUCT_SIZE'],
        }
        if f'PRIMER_INTERNAL_{i}_SEQUENCE' in result:
            row['probe'] = result[f'PRIMER_INTERNAL_{i}_SEQUENCE']
            row['probe_tm'] = result[f'PRIMER_INTERNAL_{i}_TM']
        rows.append(row)
    return pd.DataFrame(rows)

df = qpcr_results_to_df(result)
print(df)
```

## qPCR Design Guidelines

| Parameter | Primers | TaqMan Probe |
|-----------|---------|--------------|
| Length | 18-25 bp | 18-30 bp |
| Tm | 58-62C | 68-72C |
| GC% | 35-65% | 30-70% |
| Amplicon | 70-150 bp | - |
| 5' base | Any | Avoid G (quenches FAM) |

## Related Skills

- primer-basics - General PCR primer design
- primer-validation - Check primers for dimers and specificity
- sequence-manipulation - Work with cDNA sequences

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.