bio-reverse-complement

$npx mdskill add GPTomics/bioSkills/bio-reverse-complement

Generates reverse complements and complements of DNA/RNA sequences using Biopython

  • Solves tasks like primer design and strand conversion in bioinformatics
  • Relies on Biopython's Bio.Seq module for sequence manipulation
  • Applies reverse_complement() or complement() based on input sequence and user intent
  • Returns processed sequences as Seq objects or strings for downstream analysis

SKILL.md

.github/skills/bio-reverse-complementView on GitHub ↗
---
name: bio-reverse-complement
description: Generate reverse complements and complements of DNA/RNA sequences using Biopython. Use when working with opposite strands, primer design, or converting between template and coding strands.
tool_type: python
primary_tool: Bio.Seq
---

## Version Compatibility

Reference examples tested with: BioPython 1.83+, samtools 1.19+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Reverse Complement

Generate complementary and reverse complementary sequences using Biopython.

**"Get the reverse complement"** → Produce the 5'-to-3' sequence of the opposite strand.
- Python: `seq.reverse_complement()` (BioPython `Seq`)
- CLI: `samtools faidx ref.fa region --reverse-complement`

## Required Import

```python
from Bio.Seq import Seq
```

## Core Methods

### reverse_complement()

Returns the reverse complement (5' to 3' of the opposite strand).

```python
seq = Seq('ATGCGATCG')
rc = seq.reverse_complement()  # Returns Seq('CGATCGCAT')
```

This is the most commonly used operation - it gives you the sequence of the opposite strand in the conventional 5' to 3' direction.

### complement()

Returns the complement without reversing.

```python
seq = Seq('ATGCGATCG')
comp = seq.complement()  # Returns Seq('TACGCTAGC')
```

Less commonly used - gives the opposite strand but in 3' to 5' direction.

### reverse_complement_rna()

For RNA sequences (uses U instead of T):

```python
rna = Seq('AUGCGAUCG')
rc_rna = rna.reverse_complement_rna()  # Returns Seq('CGAUCGCAU')
```

### complement_rna()

```python
rna = Seq('AUGCGAUCG')
comp_rna = rna.complement_rna()  # Returns Seq('UACGCUAGC')
```

## Base Pairing Rules

### DNA

| Base | Complement |
|------|------------|
| A | T |
| T | A |
| G | C |
| C | G |

### RNA

| Base | Complement |
|------|------------|
| A | U |
| U | A |
| G | C |
| C | G |

### Ambiguous Bases (IUPAC)

| Code | Bases | Complement |
|------|-------|------------|
| R | A/G | Y |
| Y | C/T | R |
| S | G/C | S |
| W | A/T | W |
| K | G/T | M |
| M | A/C | K |
| B | C/G/T | V |
| D | A/G/T | H |
| H | A/C/T | D |
| V | A/C/G | B |
| N | A/C/G/T | N |

Biopython handles IUPAC ambiguity codes correctly.

## Code Patterns

### Basic Reverse Complement

```python
seq = Seq('ATGCGATCGATCG')
rc = seq.reverse_complement()
print(f'Original: 5\'-{seq}-3\'')
print(f'RevComp:  5\'-{rc}-3\'')
```

### Visualize Double-Stranded DNA

```python
def show_dsdna(seq):
    comp = seq.complement()
    print(f"5'-{seq}-3'")
    print(f"   {'|' * len(seq)}")
    print(f"3'-{comp}-5'")

seq = Seq('ATGCGATCG')
show_dsdna(seq)
```

### Check if Sequence is Palindrome (Self-Complementary)

```python
def is_palindrome(seq):
    return seq == seq.reverse_complement()

seq1 = Seq('GAATTC')  # EcoRI site - palindrome
seq2 = Seq('ATGCGA')  # Not a palindrome
print(f'GAATTC is palindrome: {is_palindrome(seq1)}')
print(f'ATGCGA is palindrome: {is_palindrome(seq2)}')
```

### Reverse Complement a FASTA File

**Goal:** Produce a new FASTA file with all sequences reverse-complemented.

**Approach:** Parse records, create new SeqRecords with `.reverse_complement()`, write to output.

```python
from Bio import SeqIO
from Bio.SeqRecord import SeqRecord

def reverse_complement_records(records):
    for record in records:
        yield SeqRecord(
            record.seq.reverse_complement(),
            id=record.id + '_rc',
            description=record.description + ' reverse complement'
        )

records = SeqIO.parse('sequences.fasta', 'fasta')
SeqIO.write(reverse_complement_records(records), 'sequences_rc.fasta', 'fasta')
```

### Primer Design Helper

```python
def design_primer_pair(template, start, end):
    '''Design forward and reverse primers for a region'''
    forward = template[start:start + 20]
    reverse = template[end - 20:end].reverse_complement()
    return forward, reverse

template = Seq('ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCG')
fwd, rev = design_primer_pair(template, 0, 40)
print(f'Forward primer (5\'-3\'): {fwd}')
print(f'Reverse primer (5\'-3\'): {rev}')
```

### Handle Both Strands in Analysis

**Goal:** Search for a motif on both DNA strands.

**Approach:** Search the forward sequence, then search its reverse complement. Convert positions on the reverse strand back to forward-strand coordinates.

```python
def search_both_strands(seq, motif):
    '''Search for a motif on both strands'''
    motif = Seq(motif)
    results = []
    pos = seq.find(motif)
    while pos != -1:
        results.append(('+', pos))
        pos = seq.find(motif, pos + 1)
    rc = seq.reverse_complement()
    pos = rc.find(motif)
    while pos != -1:
        results.append(('-', len(seq) - pos - len(motif)))
        pos = rc.find(motif, pos + 1)
    return results

seq = Seq('ATGCGAATTCGATCGATGAATTCGATC')
hits = search_both_strands(seq, 'GAATTC')
for strand, pos in hits:
    print(f'Found on {strand} strand at position {pos}')
```

## Common Use Cases

| Task | Method |
|------|--------|
| Get opposite strand | `reverse_complement()` |
| Primer for opposite strand | `reverse_complement()` of target region |
| Template strand from coding | `reverse_complement()` |
| Check palindrome | `seq == seq.reverse_complement()` |
| Search both strands | Search original and reverse_complement |

## Common Errors

| Error | Cause | Solution |
|-------|-------|----------|
| Wrong bases in result | Mixing DNA/RNA methods | Use `reverse_complement_rna()` for RNA |
| `TypeError` | Passing string instead of Seq | Wrap in `Seq()` first |

## Decision Tree

```
Need to work with strand orientation?
├── Get opposite strand sequence (5' to 3')?
│   └── Use reverse_complement()
├── Get base-paired sequence (same direction)?
│   └── Use complement()
├── Working with RNA?
│   └── Use reverse_complement_rna()
├── Check if restriction site (palindrome)?
│   └── seq == seq.reverse_complement()
└── Designing primers?
    └── Reverse primer = reverse_complement() of 3' end
```

## Related Skills

- seq-objects - Create Seq objects to complement
- transcription-translation - Six-frame translation uses reverse complement
- motif-search - Search both strands for motifs
- restriction-analysis/restriction-sites - Restriction sites are often palindromic
- alignment-files/sam-bam-basics - BAM FLAG indicates read strand; use samtools view -f 16 for reverse

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.