bio-rna-structure-secondary-structure-prediction

$npx mdskill add GPTomics/bioSkills/bio-rna-structure-secondary-structure-prediction

Predicts RNA secondary structures using thermodynamic models and consensus analysis

  • Solves RNA folding prediction and structural stability evaluation tasks
  • Uses ViennaRNA tools RNAfold, RNAalifold, and RNAcofold for structure prediction
  • Applies minimum free energy and partition function analysis to determine optimal structures
  • Delivers base-pair probabilities, centroid structures, and consensus outputs via command-line interface

SKILL.md

.github/skills/bio-rna-structure-secondary-structure-predictionView on GitHub ↗
---
name: bio-rna-structure-secondary-structure-prediction
description: Predicts RNA secondary structures using minimum free energy folding and partition function analysis with ViennaRNA (RNAfold, RNAalifold, RNAcofold). Computes base-pair probabilities, centroid structures, and consensus structures from alignments. Use when predicting RNA folding, evaluating structural stability, or comparing structures across homologs.
tool_type: cli
primary_tool: ViennaRNA
---

## Version Compatibility

Reference examples tested with: Infernal 1.1+, matplotlib 3.8+, numpy 1.26+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Secondary Structure Prediction

**"Predict the secondary structure of my RNA sequence"** → Compute minimum free energy (MFE) folding, base-pair probabilities via partition function, and consensus structures from alignments using thermodynamic models.
- CLI: `RNAfold` for single-sequence MFE/partition folding
- CLI: `RNAalifold` for consensus structure from alignment
- CLI: `RNAcofold` for RNA-RNA interaction structure

Predict RNA secondary structures using thermodynamic models. ViennaRNA provides MFE folding, partition function analysis, consensus structure prediction from alignments, and RNA-RNA interaction prediction.

## RNAfold: Single Sequence Folding

### MFE Structure

```bash
# Basic MFE folding (reads sequence from stdin or file)
echo "GGGAAACCC" | RNAfold

# With partition function (-p) and base-pair probabilities
echo "GGGAAACCC" | RNAfold -p

# Output PostScript dot plot and structure plot
echo ">myRNA" > input.fa
echo "GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA" >> input.fa
RNAfold -p --noPS < input.fa  # Suppress PostScript files
```

### Key RNAfold Options

| Option | Description |
|--------|-------------|
| `-p` | Compute partition function and base-pair probabilities |
| `--MEA` | Compute maximum expected accuracy structure |
| `-d2` | Dangling end energies on both sides of helices (default) |
| `-T 37` | Temperature in Celsius (default: 37) |
| `--noLP` | No lonely pairs (isolated base pairs) |
| `--noPS` | Suppress PostScript output files |
| `-C` | Read structure constraints from input |
| `--shape` | Incorporate SHAPE reactivity data |

### Constrained Folding

```bash
# Force specific positions paired/unpaired
# Constraint notation: '.' = unconstrained, 'x' = unpaired, '(' ')' = forced pair
echo -e ">constrained\nGGGCUAUUAGCUCAGUUGGUUAGAGCGCACC\n...xxxx.........................." | RNAfold -C
```

## RNAalifold: Consensus Structure from Alignment

Predicts a consensus structure from a multiple sequence alignment, combining thermodynamic stability with covariation evidence.

```bash
# Input: Stockholm or ClustalW alignment format
RNAalifold --aln alignment.sto

# With covariation weighting and partition function
RNAalifold --cfactor 0.6 --nfactor 0.5 -p alignment.sto

# RIBOSUM scoring for better covariation detection
RNAalifold --ribosum_scoring alignment.sto
```

| Option | Description |
|--------|-------------|
| `--cfactor` | Covariation weight (default: 1.0, lower = more thermodynamic) |
| `--nfactor` | Non-compatible penalty (default: 1.0) |
| `--ribosum_scoring` | Use RIBOSUM matrices for covariation |
| `-p` | Partition function for consensus |

## RNAcofold: RNA-RNA Interaction

Predicts the hybridization structure of two RNA molecules.

```bash
# Two sequences separated by '&'
echo "GCGCGC&GCGCGC" | RNAcofold

# With partition function
echo "GCGCGC&GCGCGC" | RNAcofold -p
```

## LinearFold: Fast Folding for Long Sequences

For sequences longer than ~5,000 nt, LinearFold provides O(n) time complexity instead of O(n^3).

```bash
# LinearFold (if installed separately)
echo "GGGAAACCC" | linearfold

# ViennaRNA also supports --maxBPspan for long sequences
RNAfold --maxBPspan 300 < long_sequence.fa
```

## ViennaRNA Python API

```python
import RNA

sequence = 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA'

# MFE folding
structure, mfe = RNA.fold(sequence)
print(f'Structure: {structure}')
print(f'MFE: {mfe:.2f} kcal/mol')

# Partition function and base-pair probabilities
fc = RNA.fold_compound(sequence)
structure_pf, pf_energy = fc.pf()
print(f'Ensemble energy: {pf_energy:.2f} kcal/mol')

# Base-pair probability matrix
bpp = fc.bpp()

# Centroid structure (most representative of the ensemble)
centroid, centroid_dist = fc.centroid()
print(f'Centroid: {centroid}')
print(f'Distance to ensemble: {centroid_dist:.2f}')

# MEA structure (maximum expected accuracy)
mea_struct, mea_val = fc.MEA()
print(f'MEA structure: {mea_struct}')
print(f'MEA value: {mea_val:.2f}')
```

### Folding with Constraints (Python)

```python
import RNA

sequence = 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA'

md = RNA.md()
md.uniq_ML = 1  # Unique multiloop decomposition

fc = RNA.fold_compound(sequence, md)

# Force position 10 unpaired (0-indexed)
fc.hc_add_up(10, RNA.CONSTRAINT_CONTEXT_ALL_LOOPS)

# Force positions 1-3 paired with 70-72
fc.hc_add_bp(1, 72, RNA.CONSTRAINT_CONTEXT_ALL_LOOPS)

structure, mfe = fc.mfe()
print(f'Constrained: {structure} ({mfe:.2f} kcal/mol)')
```

### SHAPE-Constrained Folding (Python)

```python
import RNA

sequence = 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA'

fc = RNA.fold_compound(sequence)

# SHAPE reactivities: negative values = no data
# Deigan et al. (2009) parameters: m=1.8, b=-0.6 (default for SHAPE)
reactivities = [-999] + [0.1, 0.05, 0.8, 0.9, 0.2, 0.1, 0.3]  # 1-indexed, -999 = missing
fc.sc_add_SHAPE_deigan(reactivities, 1.8, -0.6)

structure, mfe = fc.mfe()
print(f'SHAPE-guided: {structure} ({mfe:.2f} kcal/mol)')
```

## Structure Comparison

```python
import RNA

struct1 = '(((....)))'
struct2 = '(((....).))'

# Base-pair distance
bp_dist = RNA.bp_distance(struct1, struct2)
print(f'Base-pair distance: {bp_dist}')

# Tree edit distance (more sophisticated)
tree1 = RNA.make_tree(RNA.expand_Full(struct1))
tree2 = RNA.make_tree(RNA.expand_Full(struct2))
tree_dist = RNA.tree_edit_distance(tree1, tree2)
print(f'Tree edit distance: {tree_dist}')
```

## Structure Formats

| Format | Description | Example |
|--------|-------------|---------|
| Dot-bracket | Parentheses for pairs, dots for unpaired | `(((...)))` |
| CT (connect) | Tab-delimited: index, base, prev, next, pair, index | Standard for mfold |
| BPSEQ | Three columns: position, nucleotide, pair partner (0=unpaired) | Used by comparative databases |
| WUSS | Extended dot-bracket with pseudoknot notation | `<<..AA..>>..aa` |

### Format Conversion

```python
import RNA

sequence = 'GGGAAACCC'
structure = '(((...)))'

# Dot-bracket to base-pair list
pt = RNA.ptable(structure)
pairs = [(i, pt[i]) for i in range(1, len(pt)) if pt[i] > i]
print(f'Base pairs: {pairs}')

# Dot-bracket to BPSEQ
for i in range(1, len(sequence) + 1):
    print(f'{i} {sequence[i-1]} {pt[i]}')
```

## Visualization

### Forna (web-based)

```python
# Generate JSON for forna viewer (http://rna.tbi.univie.ac.at/forna/)
import json

forna_data = {
    'sequence': 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACC',
    'structure': '((((....((((......))))....))))'
}
print(json.dumps(forna_data))
```

### R2DT (standardized 2D layouts)

```bash
# R2DT provides template-based 2D layouts for known RNA families
# Requires Docker
docker run -v $(pwd):/data rnacentral/r2dt draw /data/input.fa /data/output/
```

### Matplotlib Dot Plot

```python
import RNA
import matplotlib.pyplot as plt
import numpy as np

sequence = 'GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA'
fc = RNA.fold_compound(sequence)
fc.pf()
bpp = fc.bpp()

n = len(sequence)
matrix = np.zeros((n, n))
for i in range(1, n + 1):
    for j in range(i + 1, n + 1):
        matrix[i-1][j-1] = bpp[i][j]

fig, ax = plt.subplots(figsize=(8, 8))
ax.imshow(matrix, cmap='YlOrRd', origin='lower', vmin=0, vmax=1)
ax.set_xlabel('Position')
ax.set_ylabel('Position')
ax.set_title('Base-pair probability matrix')
plt.tight_layout()
plt.savefig('bpp_dotplot.png', dpi=150)
```

## Quality Thresholds

| Metric | Threshold | Rationale |
|--------|-----------|-----------|
| MFE z-score | < -2.0 | Sequence folds significantly better than shuffled controls |
| Ensemble diversity | < 5.0 | Low diversity indicates a well-defined structure |
| Base-pair probability | > 0.9 | High confidence for individual pairs |
| Covariation score | > 0.0 | Positive covariation supports predicted pair |

## Related Skills

- ncrna-search - Classify structured RNAs by family using Infernal/Rfam
- structure-probing - Use experimental SHAPE/DMS data to constrain predictions
- genome-annotation/ncrna-annotation - Genome-wide ncRNA annotation
- sequence-manipulation/sequence-properties - Sequence composition analysis

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.