bio-sequence-slicing

$npx mdskill add GPTomics/bioSkills/bio-sequence-slicing

Slice, extract, and concatenate biological sequences using Biopython.

  • Handles subsequence extraction, exon joining, and region manipulation.
  • Depends on Bio.Seq objects and Python slicing syntax.
  • Adapts code patterns to match installed Biopython and samtools versions.
  • Returns sliced or joined sequence strings via Python objects.

SKILL.md

.github/skills/bio-sequence-slicingView on GitHub ↗
---
name: bio-sequence-slicing
description: Slice, extract, and concatenate biological sequences using Biopython. Use when extracting subsequences, joining sequences, or manipulating sequence regions by position.
tool_type: python
primary_tool: Bio.Seq
---

## Version Compatibility

Reference examples tested with: BioPython 1.83+, samtools 1.19+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Sequence Slicing

Extract, slice, and concatenate sequences using Biopython's Seq objects.

**"Extract a subsequence"** → Use Python slicing on Seq objects with 0-based half-open coordinates.
- Python: `seq[start:end]` (BioPython Seq)

**"Join exons into mRNA"** → Extract multiple regions and concatenate them.
- Python: `sum((seq[s:e] for s, e in coords), Seq(''))` or `+` operator

## Required Import

```python
from Bio.Seq import Seq
```

## Core Operations

### Indexing (Single Position)

```python
seq = Seq('ATGCGATCG')
seq[0]      # 'A' - first base (0-indexed)
seq[-1]     # 'G' - last base
seq[3]      # 'C' - fourth base
```

### Slicing (Extract Region)

```python
seq = Seq('ATGCGATCGATCG')
seq[0:3]     # Seq('ATG') - first 3 bases
seq[3:6]     # Seq('CGA') - positions 3-5
seq[:5]      # Seq('ATGCG') - first 5
seq[-5:]     # Seq('GATCG') - last 5
seq[::2]     # Seq('AGGTGTG') - every 2nd base
seq[::-1]    # Seq('GCTAGCTAGCGTA') - reversed
```

**Note:** Slicing returns a Seq object, not a string.

### Concatenation

```python
seq1 = Seq('ATGC')
seq2 = Seq('GGGG')
combined = seq1 + seq2  # Seq('ATGCGGGG')
```

Can also concatenate with strings:
```python
seq = Seq('ATGC')
extended = seq + 'NNNN'  # Seq('ATGCNNNN')
```

## Code Patterns

### Extract CDS by Coordinates

```python
genome = Seq('NNNNATGCGATCGATCGTAANNN')
cds_start, cds_end = 4, 21
cds = genome[cds_start:cds_end]
```

### Extract with 1-Based Coordinates

Biology often uses 1-based coordinates. Convert to 0-based:

```python
def extract_1based(seq, start, end):
    '''Extract using 1-based inclusive coordinates'''
    return seq[start - 1:end]

genome = Seq('ATGCGATCGATCG')
region = extract_1based(genome, 1, 3)  # Seq('ATG')
```

### Split Sequence into Codons

```python
def split_codons(seq):
    return [seq[i:i+3] for i in range(0, len(seq) - len(seq) % 3, 3)]

seq = Seq('ATGCGATCGATCG')
codons = split_codons(seq)  # [Seq('ATG'), Seq('CGA'), ...]
```

### Split into Fixed-Length Chunks

```python
def chunk_sequence(seq, size):
    return [seq[i:i+size] for i in range(0, len(seq), size)]

seq = Seq('ATGCGATCGATCGATCGATCG')
chunks = chunk_sequence(seq, 10)
```

### Join Sequences with Linker

```python
seqs = [Seq('ATGC'), Seq('GGGG'), Seq('TTTT')]
linker = Seq('NNN')
joined = linker.join(seqs)  # Seq('ATGCNNNGGGGNNTTTT')
```

Or manually:
```python
linker = 'NNN'
joined = Seq(linker.join(str(s) for s in seqs))
```

### Extract Multiple Regions

**Goal:** Splice non-contiguous regions (e.g., exons) into a single continuous sequence.

**Approach:** Extract each region by coordinates and concatenate with `+` or `sum()`.

```python
def extract_regions(seq, regions):
    '''Extract and concatenate multiple regions'''
    return sum((seq[start:end] for start, end in regions), Seq(''))

exon_coords = [(0, 50), (100, 150), (200, 250)]
mrna = extract_regions(genomic_seq, exon_coords)
```

### Extract Flanking Regions

```python
def get_flanking(seq, position, flank_size):
    '''Get sequence around a position'''
    start = max(0, position - flank_size)
    end = min(len(seq), position + flank_size + 1)
    return seq[start:end]

seq = Seq('ATGCGATCGATCGATCGATCG')
flanking = get_flanking(seq, 10, 5)  # 5 bp on each side of position 10
```

### Tile Sequence into Overlapping Windows

```python
def sliding_windows(seq, window_size, step=1):
    for i in range(0, len(seq) - window_size + 1, step):
        yield seq[i:i + window_size]

seq = Seq('ATGCGATCGATCG')
for window in sliding_windows(seq, 5, 2):
    print(window)
```

### Extract Feature from SeqRecord

```python
from Bio import SeqIO

for record in SeqIO.parse('sequence.gb', 'genbank'):
    for feature in record.features:
        if feature.type == 'CDS':
            cds_seq = feature.extract(record.seq)
            print(f'{feature.qualifiers.get("gene", ["?"])[0]}: {cds_seq[:30]}...')
```

### Create New SeqRecord from Slice

```python
from Bio.SeqRecord import SeqRecord

original = SeqRecord(Seq('ATGCGATCGATCGATCG'), id='full', description='Full sequence')
subset = SeqRecord(original.seq[5:15], id='subset', description=f'Positions 5-15 of {original.id}')
```

## Coordinate Systems

| System | Position 1 | Example |
|--------|------------|---------|
| 0-based (Python) | Index 0 | `seq[0:3]` gets positions 0, 1, 2 |
| 1-based (Biology) | Index 1 | Position 1-3 = `seq[0:3]` |
| 0-based half-open | Start inclusive, end exclusive | Standard Python slicing |

## Common Errors

| Error | Cause | Solution |
|-------|-------|----------|
| `IndexError` | Index out of range | Check sequence length first |
| Unexpected length | Off-by-one error | Remember end index is exclusive |
| Empty result | Start >= end | Check coordinate order |
| Wrong positions | 1-based vs 0-based confusion | Convert coordinates explicitly |

## Decision Tree

```
Need to extract or combine sequences?
├── Single position?
│   └── Use indexing: seq[i]
├── Contiguous region?
│   └── Use slicing: seq[start:end]
├── Multiple non-contiguous regions?
│   └── Extract each, concatenate with +
├── Join sequences?
│   ├── No linker: seq1 + seq2
│   └── With linker: linker.join(seqs)
├── Split into parts?
│   └── List comprehension with slicing
└── From GenBank features?
    └── Use feature.extract(record.seq)
```

## Related Skills

- seq-objects - Create Seq and SeqRecord objects
- sequence-io/read-sequences - Parse GenBank files with features to extract
- transcription-translation - Translate extracted CDS regions
- alignment-files - Extract sequences from BAM using samtools fasta/fastq

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.