bio-small-rna-seq-mirdeep2-analysis
$
npx mdskill add GPTomics/bioSkills/bio-small-rna-seq-mirdeep2-analysisDiscover and quantify miRNAs from small RNA-seq data using miRDeep2
- Identify novel miRNAs and profile known miRNAs in small RNA-seq datasets
- Uses miRDeep2 CLI tools mapper.pl, miRDeep2.pl, and quantifier.pl
- Maps reads to genome, scores precursor hairpins, and predicts miRNA candidates
- Generates ARF files and miRNA abundance tables for downstream analysis
SKILL.md
.github/skills/bio-small-rna-seq-mirdeep2-analysisView on GitHub ↗
---
name: bio-small-rna-seq-mirdeep2-analysis
description: Discover novel miRNAs and quantify known miRNAs using miRDeep2 de novo prediction from small RNA-seq data. Use when identifying new miRNAs or performing comprehensive miRNA profiling with discovery.
tool_type: cli
primary_tool: miRDeep2
---
## Version Compatibility
Reference examples tested with: pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# miRDeep2 Analysis
**"Discover novel miRNAs from my small RNA-seq data"** → Identify known and novel miRNAs by mapping reads to the genome and scoring precursor hairpin structures using a probabilistic model.
- CLI: `mapper.pl` for read mapping, `miRDeep2.pl` for de novo miRNA prediction
## Workflow Overview
```
Collapsed reads (FASTA)
|
v
mapper.pl ---------> Align to genome, create ARF file
|
v
miRDeep2.pl -------> Predict novel miRNAs, quantify known
|
v
quantifier.pl -----> Quantify known miRNAs only (optional)
```
## Step 1: Prepare Genome Index
**Goal:** Build a bowtie index from the reference genome for miRDeep2 read mapping.
**Approach:** Run bowtie-build on the genome FASTA to create the index files required by mapper.pl.
```bash
# Build bowtie index for miRDeep2 mapper
bowtie-build genome.fa genome_index
```
## Step 2: Map Reads with mapper.pl
**Goal:** Collapse identical reads and align them to the reference genome.
**Approach:** Use mapper.pl to clip adapters, filter by length, collapse duplicates, and map with bowtie to produce ARF alignment files.
```bash
# Collapse reads and map to genome
mapper.pl reads.fastq \
-e \
-h \
-i \
-j \
-k TGGAATTCTCGGGTGCCAAGG \
-l 18 \
-m \
-p genome_index \
-s reads_collapsed.fa \
-t reads_vs_genome.arf \
-v
# Key options:
# -e: Input is FASTQ
# -h: Parse Illumina headers
# -k: Clip 3' adapter
# -l 18: Discard reads < 18 nt
# -m: Collapse reads
# -p: Bowtie index prefix
# -s: Output collapsed FASTA
# -t: Output ARF alignment file
```
## Step 3: Run miRDeep2 Prediction
**Goal:** Predict novel miRNAs and quantify known miRNAs from aligned small RNA reads.
**Approach:** Run miRDeep2.pl with collapsed reads, genome, alignments, and miRBase references to score candidate miRNA loci.
```bash
# Predict novel miRNAs
miRDeep2.pl \
reads_collapsed.fa \
genome.fa \
reads_vs_genome.arf \
mature_ref.fa \
mature_other.fa \
hairpin_ref.fa \
-t Human \
2> report.log
# Arguments:
# 1. Collapsed reads FASTA
# 2. Genome FASTA
# 3. Alignment ARF file
# 4. Known mature miRNAs (same species)
# 5. Known mature miRNAs (other species, for conservation)
# 6. Known hairpin precursors
# -t: Species for miRBase lookup
```
## Prepare miRBase References
**Goal:** Download and extract species-specific miRNA references from miRBase.
**Approach:** Fetch mature and hairpin FASTA files from miRBase, then grep species-specific entries by prefix.
```bash
# Download from miRBase
wget https://www.mirbase.org/download/mature.fa
wget https://www.mirbase.org/download/hairpin.fa
# Extract species-specific sequences
grep -A1 ">hsa-" mature.fa > mature_human.fa
grep -A1 ">hsa-" hairpin.fa > hairpin_human.fa
```
## Step 4: Quantify Known miRNAs Only
**Goal:** Quantify expression of known miRNAs without running novel discovery.
**Approach:** Run quantifier.pl with hairpin and mature references against collapsed reads for fast quantification.
```bash
# If not doing novel discovery
quantifier.pl \
-p hairpin_human.fa \
-m mature_human.fa \
-r reads_collapsed.fa \
-t hsa
# Output: miRNAs_expressed_all_samples.csv
```
## Output Files
| File | Description |
|------|-------------|
| result_*.html | Interactive results report |
| result_*.csv | Predicted novel miRNAs with scores |
| miRNAs_expressed_all_samples*.csv | Expression quantification |
| pdfs_*.pdf | Secondary structure plots |
## Interpret miRDeep2 Scores
```
Score interpretation:
>10: High confidence novel miRNA
5-10: Medium confidence
1-5: Low confidence, needs validation
<1: Likely false positive
Key metrics:
- miRDeep2 score: Overall confidence
- Total read count: Expression level
- Mature/star ratio: Strand bias (expect asymmetry)
- Randfold p-value: Structural stability
```
## Parse Results in Python
**Goal:** Load miRDeep2 prediction and quantification results into pandas DataFrames.
**Approach:** Parse tab-delimited output files and filter novel miRNA predictions by confidence score threshold.
```python
import pandas as pd
def parse_mirdeep2_results(csv_path):
'''Parse miRDeep2 novel miRNA predictions'''
df = pd.read_csv(csv_path, sep='\t', skiprows=1)
# Filter high-confidence predictions
# Score > 10 indicates high confidence novel miRNA
high_conf = df[df['miRDeep2 score'] > 10]
return high_conf
# Parse quantification results
def parse_quantifier_output(csv_path):
'''Parse quantifier.pl expression matrix'''
df = pd.read_csv(csv_path, sep='\t')
return df
```
## Related Skills
- smrna-preprocessing - Prepare reads for miRDeep2
- mirge3-analysis - Faster quantification alternative
- differential-mirna - DE analysis of miRNA counts