bio-small-rna-seq-mirge3-analysis

$npx mdskill add GPTomics/bioSkills/bio-small-rna-seq-mirge3-analysis

Quantifies miRNAs and isomiRs with A-to-I editing analysis using miRge3

  • Solves fast annotation and quantification of known miRNAs from small RNA-seq data
  • Uses miRge3 with MirgeDB and organism-specific libraries for accurate detection
  • Analyzes isomiR variants and RNA editing events during read alignment and classification
  • Delivers quantified miRNA counts and editing reports in structured output directories

SKILL.md

.github/skills/bio-small-rna-seq-mirge3-analysisView on GitHub ↗
---
name: bio-small-rna-seq-mirge3-analysis
description: Fast miRNA quantification with isomiR detection and A-to-I editing analysis using miRge3. Use when quantifying known miRNAs quickly or analyzing isomiR variants and RNA editing.
tool_type: python
primary_tool: miRge3
---

## Version Compatibility

Reference examples tested with: numpy 1.26+, pandas 2.2+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# miRge3 Analysis

**"Quantify miRNAs with isomiR detection"** → Fast miRNA annotation and quantification with isomiR variant detection and A-to-I RNA editing analysis from small RNA-seq reads.
- CLI: `miRge3.0 annotate -s sample.fastq -lib human -db mirgenedb -o results/`

## Basic Quantification

**Goal:** Quantify known miRNA expression from small RNA-seq FASTQ files.

**Approach:** Run miRge3 annotation pipeline with adapter trimming, organism-specific libraries, and multi-sample input.

```bash
# Run miRge3 on FASTQ files
miRge3.0 annotate \
    -s sample1.fastq.gz,sample2.fastq.gz \
    -lib miRge3_libs \
    -on human \
    -db mirbase \
    -o output_dir \
    -a TGGAATTCTCGGGTGCCAAGG \
    --threads 8

# Key options:
# -s: Input FASTQ files (comma-separated)
# -lib: Path to miRge3 library
# -on: Organism name
# -db: Database (mirbase or mirgenedb)
# -a: 3' adapter sequence
```

## Install miRge3 Libraries

**Goal:** Download organism-specific reference libraries required for miRge3 annotation.

**Approach:** Use miRge3 built-in download command to fetch pre-built bowtie indices and annotations.

```bash
# Download pre-built libraries
miRge3.0 --download-library human mirbase

# Libraries include:
# - Bowtie indices for miRNAs, tRNAs, rRNAs
# - miRBase or MirGeneDB annotations
# - A-to-I editing sites
```

## IsomiR Detection

**Goal:** Identify and quantify isomiR variants including 5'/3' additions, deletions, and internal modifications.

**Approach:** Enable miRge3 isomiR mode to classify reads by their deviation from canonical miRNA sequences.

```bash
# Enable isomiR analysis
miRge3.0 annotate \
    -s sample.fastq.gz \
    -lib miRge3_libs \
    -on human \
    -db mirbase \
    --isomir \
    -o output_dir

# IsomiRs include:
# - 5' variants (templated and non-templated)
# - 3' variants (templated and non-templated)
# - Internal modifications
```

## A-to-I RNA Editing

**Goal:** Detect adenosine-to-inosine RNA editing events in miRNA sequences.

**Approach:** Enable miRge3 A-to-I detection mode which identifies editing sites and calculates editing frequencies.

```bash
# Detect A-to-I editing
miRge3.0 annotate \
    -s sample.fastq.gz \
    -lib miRge3_libs \
    -on human \
    -db mirbase \
    --AtoI \
    -o output_dir

# Outputs editing sites and frequencies
```

## Output Files

| File | Description |
|------|-------------|
| miR.Counts.csv | Raw read counts per miRNA |
| miR.RPM.csv | RPM normalized counts |
| isomiR.Counts.csv | IsomiR-level counts |
| isomiR.summary.csv | IsomiR summary per miRNA |
| annotation.report.html | Interactive QC report |

## Python API

**Goal:** Run miRge3 quantification programmatically from Python.

**Approach:** Call the miRge3 annotate function directly with configuration parameters instead of CLI invocation.

```python
from mirge3.annotate import annotate

# Run programmatically
annotate(
    samples=['sample1.fastq.gz', 'sample2.fastq.gz'],
    lib_path='miRge3_libs',
    organism='human',
    database='mirbase',
    adapter='TGGAATTCTCGGGTGCCAAGG',
    output_dir='results',
    threads=8
)
```

## Parse miRge3 Output

**Goal:** Load miRge3 count matrices and isomiR tables into pandas for downstream analysis.

**Approach:** Read CSV output files and apply minimum count filtering to remove lowly-expressed miRNAs.

```python
import pandas as pd

def load_mirge3_counts(output_dir):
    '''Load miRge3 count matrix'''
    counts = pd.read_csv(f'{output_dir}/miR.Counts.csv', index_col=0)
    return counts

def load_isomirs(output_dir):
    '''Load isomiR-level counts'''
    isomirs = pd.read_csv(f'{output_dir}/isomiR.Counts.csv', index_col=0)
    return isomirs

# Filter low-expressed miRNAs
def filter_low_counts(counts, min_total=10):
    '''Keep miRNAs with total count >= threshold'''
    return counts[counts.sum(axis=1) >= min_total]
```

## Compare Multiple Samples

**Goal:** Normalize and transform miRNA counts for cross-sample comparison.

**Approach:** Apply RPM normalization to account for library size, then log2-transform for variance stabilization.

```python
def normalize_rpm(counts):
    '''Normalize to reads per million'''
    total_per_sample = counts.sum(axis=0)
    rpm = counts / total_per_sample * 1e6
    return rpm

def log_transform(rpm, pseudocount=1):
    '''Log2 transform with pseudocount'''
    import numpy as np
    return np.log2(rpm + pseudocount)
```

## IsomiR Analysis

**Goal:** Summarize isomiR diversity metrics per canonical miRNA.

**Approach:** Group isomiR-level counts by parent miRNA and compute total reads, variant count, and dominant isoform.

```python
def summarize_isomirs(isomir_counts):
    '''Summarize isomiR diversity per miRNA'''
    # Group by canonical miRNA
    isomir_counts['miRNA'] = isomir_counts.index.str.extract(r'(hsa-\w+-\d+[a-z]*)')[0]

    summary = isomir_counts.groupby('miRNA').agg({
        'count': ['sum', 'count', lambda x: x.idxmax()]
    })
    summary.columns = ['total_reads', 'n_isomirs', 'dominant_isomir']
    return summary
```

## Related Skills

- smrna-preprocessing - Prepare reads for miRge3
- mirdeep2-analysis - Alternative with novel miRNA discovery
- differential-mirna - DE analysis of miRge3 counts

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.