bio-small-rna-seq-smrna-preprocessing

$npx mdskill add GPTomics/bioSkills/bio-small-rna-seq-smrna-preprocessing

Preprocess small RNA-seq data for miRNA and piRNA analysis

  • Trim 3' adapters and filter read lengths for small RNA analysis
  • Uses cutadapt and fastp for adapter trimming and quality filtering
  • Applies size selection filters (e.g., 18-30 nt for miRNA)
  • Outputs trimmed and filtered FASTQ files for downstream analysis

SKILL.md

.github/skills/bio-small-rna-seq-smrna-preprocessingView on GitHub ↗
---
name: bio-small-rna-seq-smrna-preprocessing
description: Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
tool_type: cli
primary_tool: cutadapt
---

## Version Compatibility

Reference examples tested with: cutadapt 4.4+, fastp 0.23+, matplotlib 3.8+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Small RNA Preprocessing

**"Preprocess my small RNA-seq reads"** → Remove 3' adapter sequences and size-select reads in the small RNA range (18-30 nt for miRNA, 24-32 nt for piRNA) before quantification or discovery.
- CLI: `cutadapt -a ADAPTER -m 18 -M 30 -o trimmed.fastq input.fastq`

## Adapter Trimming with Cutadapt

**Goal:** Remove 3' adapter sequences and size-select reads in the small RNA range.

**Approach:** Run cutadapt with the kit-specific adapter, minimum/maximum length filters, and discard reads without adapter.

Small RNA libraries have specific 3' adapters that must be removed:

```bash
# Standard Illumina TruSeq small RNA adapter
cutadapt \
    -a TGGAATTCTCGGGTGCCAAGG \
    -m 18 \
    -M 30 \
    --discard-untrimmed \
    -o trimmed.fastq.gz \
    input.fastq.gz

# -a: 3' adapter sequence
# -m 18: Minimum length (miRNAs are 18-25 nt)
# -M 30: Maximum length (exclude longer fragments)
# --discard-untrimmed: Remove reads without adapter (likely not small RNA)
```

## Common Small RNA Adapters

| Kit | 3' Adapter Sequence |
|-----|---------------------|
| Illumina TruSeq | TGGAATTCTCGGGTGCCAAGG |
| NEBNext | AGATCGGAAGAGCACACGTCT |
| QIAseq | AACTGTAGGCACCATCAAT |
| Lexogen | TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC |

## Size Selection

```bash
# Filter by length after trimming
cutadapt \
    -a TGGAATTCTCGGGTGCCAAGG \
    -m 18 -M 26 \
    -o mirna_length.fastq.gz \
    input.fastq.gz

# miRNA: 18-26 nt (typically 21-23 nt)
# piRNA: 26-32 nt
# snoRNA: variable, typically longer
```

## Quality Trimming

```bash
# Trim low-quality bases from 3' end before adapter removal
cutadapt \
    -q 20 \
    -a TGGAATTCTCGGGTGCCAAGG \
    -m 18 \
    -o trimmed.fastq.gz \
    input.fastq.gz
```

## Using fastp for Small RNA

```bash
# fastp with small RNA settings
fastp \
    --in1 input.fastq.gz \
    --out1 trimmed.fastq.gz \
    --adapter_sequence TGGAATTCTCGGGTGCCAAGG \
    --length_required 18 \
    --length_limit 30 \
    --html report.html

# Note: fastp auto-detects adapters but specifying is more reliable
```

## Collapse Identical Reads

For small RNAs, collapsing identical sequences reduces computation:

```bash
# Using seqkit
seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta

# Using fastx_toolkit (legacy)
fastx_collapser -i trimmed.fastq -o collapsed.fasta
```

## Python Preprocessing

```python
import gzip
from collections import Counter

def collapse_reads(fastq_path):
    '''Collapse identical sequences and count occurrences'''
    counts = Counter()

    with gzip.open(fastq_path, 'rt') as f:
        while True:
            header = f.readline()
            if not header:
                break
            seq = f.readline().strip()
            f.readline()  # +
            f.readline()  # qual

            # Only keep reads in miRNA size range
            if 18 <= len(seq) <= 26:
                counts[seq] += 1

    return counts

# Write collapsed FASTA
def write_collapsed_fasta(counts, output_path):
    with open(output_path, 'w') as f:
        for i, (seq, count) in enumerate(counts.most_common()):
            f.write(f'>seq_{i}_x{count}\n{seq}\n')
```

## QC Metrics for Small RNA

Key metrics to check:
- Read length distribution (should peak at 21-23 nt for miRNA)
- Adapter content (high if library is good)
- Percentage of reads in target size range

```python
import matplotlib.pyplot as plt
from collections import Counter

def plot_length_distribution(fastq_path):
    lengths = Counter()
    with gzip.open(fastq_path, 'rt') as f:
        for i, line in enumerate(f):
            if i % 4 == 1:  # Sequence line
                lengths[len(line.strip())] += 1

    plt.bar(lengths.keys(), lengths.values())
    plt.xlabel('Read Length')
    plt.ylabel('Count')
    plt.title('Small RNA Length Distribution')
    plt.savefig('length_dist.png')
```

## Related Skills

- mirdeep2-analysis - Novel miRNA discovery
- mirge3-analysis - Fast miRNA quantification
- read-qc/adapter-trimming - General adapter trimming

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.