bio-small-rna-seq-smrna-preprocessing
$
npx mdskill add GPTomics/bioSkills/bio-small-rna-seq-smrna-preprocessingPreprocess small RNA-seq data for miRNA and piRNA analysis
- Trim 3' adapters and filter read lengths for small RNA analysis
- Uses cutadapt and fastp for adapter trimming and quality filtering
- Applies size selection filters (e.g., 18-30 nt for miRNA)
- Outputs trimmed and filtered FASTQ files for downstream analysis
SKILL.md
.github/skills/bio-small-rna-seq-smrna-preprocessingView on GitHub ↗
---
name: bio-small-rna-seq-smrna-preprocessing
description: Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
tool_type: cli
primary_tool: cutadapt
---
## Version Compatibility
Reference examples tested with: cutadapt 4.4+, fastp 0.23+, matplotlib 3.8+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Small RNA Preprocessing
**"Preprocess my small RNA-seq reads"** → Remove 3' adapter sequences and size-select reads in the small RNA range (18-30 nt for miRNA, 24-32 nt for piRNA) before quantification or discovery.
- CLI: `cutadapt -a ADAPTER -m 18 -M 30 -o trimmed.fastq input.fastq`
## Adapter Trimming with Cutadapt
**Goal:** Remove 3' adapter sequences and size-select reads in the small RNA range.
**Approach:** Run cutadapt with the kit-specific adapter, minimum/maximum length filters, and discard reads without adapter.
Small RNA libraries have specific 3' adapters that must be removed:
```bash
# Standard Illumina TruSeq small RNA adapter
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-M 30 \
--discard-untrimmed \
-o trimmed.fastq.gz \
input.fastq.gz
# -a: 3' adapter sequence
# -m 18: Minimum length (miRNAs are 18-25 nt)
# -M 30: Maximum length (exclude longer fragments)
# --discard-untrimmed: Remove reads without adapter (likely not small RNA)
```
## Common Small RNA Adapters
| Kit | 3' Adapter Sequence |
|-----|---------------------|
| Illumina TruSeq | TGGAATTCTCGGGTGCCAAGG |
| NEBNext | AGATCGGAAGAGCACACGTCT |
| QIAseq | AACTGTAGGCACCATCAAT |
| Lexogen | TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC |
## Size Selection
```bash
# Filter by length after trimming
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 -M 26 \
-o mirna_length.fastq.gz \
input.fastq.gz
# miRNA: 18-26 nt (typically 21-23 nt)
# piRNA: 26-32 nt
# snoRNA: variable, typically longer
```
## Quality Trimming
```bash
# Trim low-quality bases from 3' end before adapter removal
cutadapt \
-q 20 \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-o trimmed.fastq.gz \
input.fastq.gz
```
## Using fastp for Small RNA
```bash
# fastp with small RNA settings
fastp \
--in1 input.fastq.gz \
--out1 trimmed.fastq.gz \
--adapter_sequence TGGAATTCTCGGGTGCCAAGG \
--length_required 18 \
--length_limit 30 \
--html report.html
# Note: fastp auto-detects adapters but specifying is more reliable
```
## Collapse Identical Reads
For small RNAs, collapsing identical sequences reduces computation:
```bash
# Using seqkit
seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta
# Using fastx_toolkit (legacy)
fastx_collapser -i trimmed.fastq -o collapsed.fasta
```
## Python Preprocessing
```python
import gzip
from collections import Counter
def collapse_reads(fastq_path):
'''Collapse identical sequences and count occurrences'''
counts = Counter()
with gzip.open(fastq_path, 'rt') as f:
while True:
header = f.readline()
if not header:
break
seq = f.readline().strip()
f.readline() # +
f.readline() # qual
# Only keep reads in miRNA size range
if 18 <= len(seq) <= 26:
counts[seq] += 1
return counts
# Write collapsed FASTA
def write_collapsed_fasta(counts, output_path):
with open(output_path, 'w') as f:
for i, (seq, count) in enumerate(counts.most_common()):
f.write(f'>seq_{i}_x{count}\n{seq}\n')
```
## QC Metrics for Small RNA
Key metrics to check:
- Read length distribution (should peak at 21-23 nt for miRNA)
- Adapter content (high if library is good)
- Percentage of reads in target size range
```python
import matplotlib.pyplot as plt
from collections import Counter
def plot_length_distribution(fastq_path):
lengths = Counter()
with gzip.open(fastq_path, 'rt') as f:
for i, line in enumerate(f):
if i % 4 == 1: # Sequence line
lengths[len(line.strip())] += 1
plt.bar(lengths.keys(), lengths.values())
plt.xlabel('Read Length')
plt.ylabel('Count')
plt.title('Small RNA Length Distribution')
plt.savefig('length_dist.png')
```
## Related Skills
- mirdeep2-analysis - Novel miRNA discovery
- mirge3-analysis - Fast miRNA quantification
- read-qc/adapter-trimming - General adapter trimming