bio-workflows-crispr-editing-pipeline

$npx mdskill add GPTomics/bioSkills/bio-workflows-crispr-editing-pipeline

Design complete CRISPR experiments from target selection to delivery-ready constructs.

  • Generates guide RNA designs, off-target assessments, and specialized editing strategies.
  • Depends on genome-engineering tools for GRNA design, off-target prediction, base editing, prime editing, and HDR template design.
  • Validates outputs against activity scores, specificity thresholds, and homology arm verification.
  • Delivers delivery-ready constructs with QC checkpoints ensuring safety and efficacy.

SKILL.md

.github/skills/bio-workflows-crispr-editing-pipelineView on GitHub ↗
---
name: bio-workflows-crispr-editing-pipeline
description: End-to-end CRISPR experiment design from target selection to delivery-ready constructs. Covers guide RNA design, off-target assessment, and specialized editing strategies including knockouts, base editing, and HDR knockins. Use when designing complete CRISPR editing experiments for gene knockout, correction, or tagging.
tool_type: mixed
primary_tool: crisprscan
workflow: true
depends_on:
  - genome-engineering/grna-design
  - genome-engineering/off-target-prediction
  - genome-engineering/base-editing-design
  - genome-engineering/prime-editing-design
  - genome-engineering/hdr-template-design
qc_checkpoints:
  - after_grna_design: "Activity score >0.6, no poly-T runs, GC 40-70%"
  - after_offtarget: "Specificity score >0.7, no coding off-targets with <3 mismatches"
  - after_template: "Homology arms verified, PAM disrupted in donor"
---

## Version Compatibility

Reference examples tested with: BioPython 1.83+, matplotlib 3.8+, numpy 1.26+, pandas 2.2+, primer3-py 2.0+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# CRISPR Editing Pipeline

**"Design a complete CRISPR editing experiment for my target gene"** → Orchestrate guide RNA design, off-target assessment, and strategy-specific template design (knockout, base editing, HDR knock-in, or prime editing) to produce delivery-ready constructs.

Complete workflow for CRISPR experiment design: from target gene to delivery-ready constructs with branching paths for different editing strategies.

## Workflow Overview

```
Target Gene/Position
        |
        v
[1. Guide RNA Design] --> CRISPRscan / Rule Set 2 / DeepCRISPR
        |
        v
[2. Off-Target Assessment] --> Cas-OFFinder + CFD scoring
        |
        v
    Decision Point: What type of edit?
        |
    +---+-------------------+--------------------+
    |                       |                    |
    v                       v                    v
[3a. Knockout]        [3b. Base Editing]   [3c. Knockin]
 Standard Cas9         CBE/ABE design       HDR template
 Frameshift            C>T or A>G           with homology arms
        |                   |                    |
        v                   v                    v
    Final Constructs with Validation Primers
```

## Prerequisites

```bash
pip install crisprscan biopython pandas numpy matplotlib

conda install -c bioconda primer3-py cas-offinder

# Python packages for scoring
pip install crisprtools  # if available
```

## Primary Path: Gene Knockout

### Step 1: Guide RNA Design

```python
from Bio import SeqIO
from Bio.Seq import Seq
import pandas as pd
import re

def find_guides(sequence, pam='NGG'):
    '''Find all potential gRNA target sites with NGG PAM.'''
    guides = []
    seq_str = str(sequence).upper()

    # Forward strand: 20bp + NGG
    for match in re.finditer(r'(?=([ATCG]{20}[ATCG]GG))', seq_str):
        pos = match.start()
        target = match.group(1)[:20]
        pam_seq = match.group(1)[20:23]
        guides.append({
            'sequence': target,
            'pam': pam_seq,
            'position': pos,
            'strand': '+',
            'full_target': match.group(1)
        })

    # Reverse strand: CCN + 20bp
    for match in re.finditer(r'(?=(CC[ATCG][ATCG]{20}))', seq_str):
        pos = match.start()
        full = match.group(1)
        target = str(Seq(full[3:23]).reverse_complement())
        pam_seq = str(Seq(full[0:3]).reverse_complement())
        guides.append({
            'sequence': target,
            'pam': pam_seq,
            'position': pos,
            'strand': '-',
            'full_target': full
        })

    return pd.DataFrame(guides)


def score_guide(guide_seq):
    '''Score guide using Rule Set 2-like heuristics.'''
    score = 0.5  # Base score

    # GC content (optimal: 40-70%)
    gc = (guide_seq.count('G') + guide_seq.count('C')) / len(guide_seq)
    if 0.4 <= gc <= 0.7:
        score += 0.2
    elif gc < 0.3 or gc > 0.8:
        score -= 0.2

    # No poly-T (>4 T's is Pol III terminator)
    if 'TTTT' in guide_seq:
        score -= 0.3

    # G at position 20 (adjacent to PAM) preferred
    if guide_seq[-1] == 'G':
        score += 0.1

    # Avoid GG at positions 19-20
    if guide_seq[-2:] == 'GG':
        score -= 0.1

    # Seed region (positions 12-20) GC
    seed = guide_seq[11:20]
    seed_gc = (seed.count('G') + seed.count('C')) / len(seed)
    if 0.4 <= seed_gc <= 0.7:
        score += 0.1

    return min(1.0, max(0.0, score))


# Example: Design guides for BRCA1 exon
gene_seq = '''ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGT
GTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTG'''

guides = find_guides(gene_seq.replace('\n', ''))
guides['activity_score'] = guides['sequence'].apply(score_guide)

# Filter high-scoring guides
# Activity score >0.6 is standard threshold for reliable editing
good_guides = guides[guides['activity_score'] > 0.6].sort_values('activity_score', ascending=False)
print(f'Found {len(good_guides)} high-scoring guides')
print(good_guides[['sequence', 'position', 'strand', 'activity_score']].head(10))
```

### Step 2: Off-Target Assessment

```python
import subprocess
from pathlib import Path

def run_cas_offinder(guides_df, genome_fasta, output_dir, max_mismatches=4):
    '''Run Cas-OFFinder for off-target detection.'''
    output_dir = Path(output_dir)
    output_dir.mkdir(parents=True, exist_ok=True)

    # Write input file
    input_file = output_dir / 'cas_offinder_input.txt'
    with open(input_file, 'w') as f:
        f.write(f'{genome_fasta}\n')
        f.write('NNNNNNNNNNNNNNNNNNNNNGG\n')  # 20bp + NGG pattern
        for _, row in guides_df.iterrows():
            f.write(f"{row['sequence']}NNN {max_mismatches}\n")

    # Run Cas-OFFinder
    output_file = output_dir / 'offtargets.txt'
    subprocess.run([
        'cas-offinder', str(input_file), 'C', str(output_file)  # C for CPU
    ], check=True)

    # Parse results
    offtargets = pd.read_csv(output_file, sep='\t', header=None,
                              names=['pattern', 'chromosome', 'position', 'target',
                                    'strand', 'mismatches'])
    return offtargets


def calculate_specificity_score(guide_seq, offtargets_df):
    '''Calculate CFD-based specificity score.'''
    # Simplified: penalize based on mismatch count and position
    guide_offtargets = offtargets_df[offtargets_df['pattern'].str.contains(guide_seq[:10])]

    if len(guide_offtargets) == 0:
        return 1.0

    # Weight by mismatch count (more mismatches = lower penalty)
    penalty = 0
    for _, ot in guide_offtargets.iterrows():
        mm = ot['mismatches']
        if mm == 0:  # Perfect match elsewhere (bad!)
            penalty += 1.0
        elif mm == 1:
            penalty += 0.5
        elif mm == 2:
            penalty += 0.2
        elif mm == 3:
            penalty += 0.1
        else:
            penalty += 0.05

    # Specificity score: higher is better
    # Score >0.7 is generally acceptable
    return max(0, 1 - penalty / 10)


# Filter by off-target profile
good_guides['specificity_score'] = good_guides['sequence'].apply(
    lambda x: calculate_specificity_score(x, pd.DataFrame())  # placeholder
)

# Combined score
good_guides['combined_score'] = (good_guides['activity_score'] * 0.5 +
                                  good_guides['specificity_score'] * 0.5)
final_guides = good_guides.sort_values('combined_score', ascending=False).head(5)
```

### Step 3a: Knockout Design (Frameshift)

```python
def design_knockout(guide_row, target_sequence):
    '''Design knockout experiment with validation primers.'''
    guide_seq = guide_row['sequence']
    position = guide_row['position']

    # Cas9 cuts 3bp upstream of PAM
    cut_site = position + 17 if guide_row['strand'] == '+' else position + 6

    # Validation primers flanking cut site (~200bp amplicon)
    # 200bp amplicon is optimal for detecting indels by gel or Sanger
    left_start = max(0, cut_site - 100)
    right_end = min(len(target_sequence), cut_site + 100)

    return {
        'guide_sequence': guide_seq,
        'pam': guide_row['pam'],
        'cut_site': cut_site,
        'expected_outcome': 'Frameshift indel',
        'validation_amplicon_start': left_start,
        'validation_amplicon_end': right_end
    }

ko_design = design_knockout(final_guides.iloc[0], gene_seq.replace('\n', ''))
print('Knockout Design:')
for k, v in ko_design.items():
    print(f'  {k}: {v}')
```

### Step 3b: Base Editing Design (CBE/ABE)

```python
def design_base_edit(target_position, target_sequence, edit_type='CBE'):
    '''Design base editing experiment.
    CBE: C>T conversion (or G>A on opposite strand)
    ABE: A>G conversion (or T>C on opposite strand)

    Editing window: positions 4-8 in the protospacer (counting from PAM-distal)
    '''
    guides = find_guides(target_sequence)

    suitable_guides = []
    for _, guide in guides.iterrows():
        guide_start = guide['position']
        guide_end = guide_start + 20

        # Check if target position falls in editing window (positions 4-8)
        # Window position 4-8 is optimal for BE3/BE4 (CBE) and ABE7.10/ABE8
        if guide['strand'] == '+':
            window_start = guide_start + 3  # Position 4
            window_end = guide_start + 8    # Position 8
        else:
            window_start = guide_end - 8
            window_end = guide_end - 3

        if window_start <= target_position <= window_end:
            # Check if target base is appropriate
            target_base = target_sequence[target_position].upper()
            if edit_type == 'CBE' and target_base in ['C', 'G']:
                suitable_guides.append(guide)
            elif edit_type == 'ABE' and target_base in ['A', 'T']:
                suitable_guides.append(guide)

    return pd.DataFrame(suitable_guides)


# Example: Design CBE to introduce stop codon
# C>T at specific position can create TAG/TAA/TGA stop
target_pos = 45  # Example position with C
cbe_guides = design_base_edit(target_pos, gene_seq.replace('\n', ''), 'CBE')
print(f'Found {len(cbe_guides)} CBE-compatible guides')
```

### Step 3c: Knockin Design (HDR Template)

```python
def design_hdr_template(guide_row, target_sequence, insert_sequence,
                         homology_arm_length=800):
    '''Design HDR donor template with homology arms.

    Homology arm length: 800bp is standard for plasmid donors.
    For ssODN, use 30-60bp arms.
    '''
    cut_site = guide_row['position'] + 17 if guide_row['strand'] == '+' else guide_row['position'] + 6

    # Extract homology arms
    # Arms flank the cut site
    left_arm_start = max(0, cut_site - homology_arm_length)
    left_arm = target_sequence[left_arm_start:cut_site]

    right_arm_end = min(len(target_sequence), cut_site + homology_arm_length)
    right_arm = target_sequence[cut_site:right_arm_end]

    # Mutate PAM in donor to prevent re-cutting
    # Change NGG to NGA or NAG (silent if possible)
    guide_seq = guide_row['sequence']
    pam_position_in_arms = cut_site - left_arm_start + 3

    # Full donor: left_arm + insert + right_arm
    donor = left_arm + insert_sequence + right_arm

    return {
        'guide_sequence': guide_seq,
        'cut_site': cut_site,
        'left_arm': left_arm,
        'right_arm': right_arm,
        'insert': insert_sequence,
        'donor_template': donor,
        'donor_length': len(donor),
        'note': 'Remember to mutate PAM in donor to prevent re-cutting'
    }


# Example: Insert GFP tag
gfp_sequence = 'ATGGTGAGCAAGGGCGAGGAG...'  # Truncated for example
hdr_design = design_hdr_template(final_guides.iloc[0], gene_seq.replace('\n', ''), 'FLAG_TAG', 50)
print('HDR Design:')
print(f"  Left arm length: {len(hdr_design['left_arm'])}")
print(f"  Right arm length: {len(hdr_design['right_arm'])}")
print(f"  Total donor length: {hdr_design['donor_length']}")
```

## Visualization

```python
import matplotlib.pyplot as plt
import matplotlib.patches as mpatches
import numpy as np

def plot_guide_landscape(guides_df, gene_length, exon_coords=None):
    '''Visualize guide positions and scores along gene.'''
    fig, axes = plt.subplots(2, 1, figsize=(14, 6), gridspec_kw={'height_ratios': [1, 2]})

    # Top: Gene structure
    ax1 = axes[0]
    ax1.axhline(y=0.5, color='gray', linewidth=10, solid_capstyle='butt')

    if exon_coords:
        for start, end in exon_coords:
            ax1.axhline(y=0.5, xmin=start/gene_length, xmax=end/gene_length,
                       color='steelblue', linewidth=20, solid_capstyle='butt')

    ax1.set_xlim(0, gene_length)
    ax1.set_ylim(0, 1)
    ax1.set_ylabel('Gene')
    ax1.set_xticks([])
    ax1.set_yticks([])

    # Bottom: Guide scores
    ax2 = axes[1]
    colors = ['green' if s > 0.6 else 'orange' if s > 0.4 else 'red'
              for s in guides_df['activity_score']]

    ax2.scatter(guides_df['position'], guides_df['activity_score'],
                c=colors, s=50, alpha=0.7)
    ax2.axhline(y=0.6, color='green', linestyle='--', alpha=0.5, label='Threshold')
    ax2.set_xlim(0, gene_length)
    ax2.set_ylim(0, 1)
    ax2.set_xlabel('Position (bp)')
    ax2.set_ylabel('Activity Score')
    ax2.legend()

    plt.tight_layout()
    plt.savefig('guide_landscape.pdf')
    return fig


# Plot
plot_guide_landscape(guides, len(gene_seq.replace('\n', '')),
                     exon_coords=[(0, 50), (70, 130)])
```

## Parameter Recommendations

| Step | Parameter | Value | Rationale |
|------|-----------|-------|-----------|
| Guide design | Activity score | >0.6 | Standard threshold for reliable editing |
| Guide design | GC content | 40-70% | Optimal for binding and Cas9 activity |
| Off-target | Max mismatches | 4 | Catches most relevant off-targets |
| Off-target | Specificity score | >0.7 | Acceptable off-target profile |
| Base editing | Window | positions 4-8 | Optimal for BE3/BE4, ABE7.10 |
| HDR | Homology arms | 800bp | Standard for plasmid donors |
| HDR (ssODN) | Homology arms | 30-60bp | For single-strand oligo donors |

## Troubleshooting

| Issue | Likely Cause | Solution |
|-------|--------------|----------|
| No high-scoring guides | GC-poor region | Expand search region, consider Cas12a |
| Many off-targets | Repetitive sequence | Use high-fidelity Cas9 (eSpCas9, HiFi) |
| Low HDR efficiency | NHEJ dominant | Add NHEJ inhibitors, use ssODN |
| Base editing outside window | Guide position | Redesign with target in positions 4-8 |
| Bystander edits | Multiple C/A in window | Design guides with single target base |

## Output Files

| File | Description |
|------|-------------|
| `guides_ranked.tsv` | All guides with activity and specificity scores |
| `offtargets.txt` | Cas-OFFinder results |
| `knockout_design.json` | KO guide and validation primers |
| `base_edit_design.json` | CBE/ABE design with editing window |
| `hdr_template.fasta` | Donor template sequence |
| `guide_landscape.pdf` | Visualization of guide positions |

## Related Skills

- genome-engineering/grna-design - Detailed scoring algorithms
- genome-engineering/off-target-prediction - Cas-OFFinder and CFD
- genome-engineering/base-editing-design - CBE/ABE specifics
- genome-engineering/prime-editing-design - pegRNA design
- genome-engineering/hdr-template-design - Donor optimization
- primer-design/primer-basics - Validation primer design

More from GPTomics/bioSkills

SkillDescription
bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.